2015.11.27 Community Chat
( Link back to Dev Chat archive )
Elves: lol [3:00 PM]
Elves: hi everybody! [3:00 PM]
Jennifer Pearl: hi Elves [3:00 PM]
whbob: Hi Elves [3:01 PM]
Elves: happy firday [3:00 PM]
Jennifer Pearl: did you get my email? [3:00 PM]
Elves: and / or post thanksgivingness depending on where everybody is [3:00 PM]
Jennifer Pearl: yes happy thanksgiving [3:01 PM]
Elves: Hi Jen, yes I received your email, thank you! [3:01 PM]
Jennifer Pearl: cool. I figured out the logic for it [3:01 PM]
Elves: that's awesome, huge congratulations!! [3:01 PM]
Jennifer Pearl: thanks. Do you know if the devs will be here? [3:02 PM]
Elves: wow, reading through the details, so you can get the structure for both states? [3:02 PM]
Jennifer Pearl: yes [3:02 PM]
Jennifer Pearl: with an oligo [3:03 PM]
Jennifer Pearl: instead of FMN [3:03 PM]
Elves: i'm not sure about dev attendance today since it is a community chat, and also thanksgiving week, i would not expect, I think Stanford is mostly taking the week off [3:03 PM]
Elves: but who knows, maybe someone will pop in :D [3:03 PM]
Elves: hi whbob! welcome back [3:03 PM]
Jennifer Pearl: k [3:03 PM]
whbob: Thanks [3:04 PM]
Elves: i was thinking that since labs are due on the 30th, a good project for today would be doing a walkthrough to complete a lab submission [3:04 PM]
Elves: like maybe a mod, since we already introduced those concepts, and we could possibly complete and submit a molecule? [3:04 PM]
Elves: also if anyone has anything to share, you're welcome. Jen I'd love to hear more about your progress on dpat [3:05 PM]
Jennifer Pearl: i kinda have a secret project [3:05 PM]
Elves: lol [3:05 PM]
Elves: i just so happe to love secret projects [3:05 PM]
Elves: if it's the one you wrote about that sounds very cool and if it's something else, i look forward to whatever the future holds :D :D :D [3:06 PM]
Jennifer Pearl: its the first [3:07 PM]
Jennifer Pearl: I guess I can talk about it [3:07 PM]
Elves: excellent, that sounds very useful [3:07 PM]
Elves: feel free to save for when developed, i know things are prone to change mid dev. or share, either way! [3:07 PM]
Jennifer Pearl: just the overview [3:07 PM]
Elves: cool! [3:07 PM]
Jennifer Pearl: im writing a program that takes a sequence and sinlge oligo and finds teh secondary structure for both states and then finds the different mods of that structure that match the original secondary structure [3:09 PM]
Jennifer Pearl: mods of that sequence [3:09 PM]
Jennifer Pearl: while using contraints found sifting through the partition function [3:10 PM]
Elves: does that mean in other words that you are able to create a list of sequences that each are predicted to take the same secondary structure? [3:10 PM]
Jennifer Pearl: yes [3:10 PM]
Elves: so we get a variety of nucleotide sequences, each making the same shape [3:10 PM]
Jennifer Pearl: yes [3:10 PM]
Jennifer Pearl: and right now it will give the ensemble diversity for each sequence [3:11 PM]
Jennifer Pearl: or at least that is the plan [3:11 PM]
Jennifer Pearl: i have the logic for it now and will wokr on this weekend and ,make submissions this round...hopefully [3:11 PM]
Jennifer Pearl: doing something int eh same vein as last weeks chat where I asked people to collect and design to the Ensemble defect in Nupack [3:12 PM]
whbob: Sounds great! [3:13 PM]
Jennifer Pearl: but automated and able to use same structures so that will remove one more variable from the analyiss so help make better decisions [3:13 PM]
Jennifer Pearl: nicknaming it Remmy [3:13 PM]
LFP6: Hey, Jen? [3:13 PM]
LFP6: How important is it for you to get the target state from my script? [3:13 PM]
Jennifer Pearl: can only get ensemble diversity for the state without the oligo though so there is that though [3:14 PM]
LFP6: I'm debating doing a release of everything except that [3:14 PM]
LFP6: And not doing more until the new API is up [3:14 PM]
Jennifer Pearl: @LFP6 if it is a NG lab then target state strucutes are not needed [3:16 PM]
LFP6: NG? [3:15 PM]
Jennifer Pearl: if it is for a lab with a defined target it may be usefull but not currently used [3:17 PM]
LFP6: Ok [3:16 PM]
LFP6: So is it ok if I leave that out of the release? [3:16 PM]
Jennifer Pearl: sure [3:17 PM]
LFP6: Ok [3:16 PM]
LFP6: Cool' [3:16 PM]
Jennifer Pearl: if I need it later I will ask for it [3:17 PM]
LFP6: I'm planning on basically rewriting it for the version using the new API [3:17 PM]
Jennifer Pearl: cool [3:19 PM]
Jennifer Pearl: just leave teh old one up though [3:19 PM]
LFP6: Will do [3:18 PM]
Jennifer Pearl: im still using it [3:19 PM]
LFP6: And FYI, it isn't JSON at this point [3:18 PM]
LFP6: But I did move around a couple of the columns, I believe [3:19 PM]
Jennifer Pearl: if it is the original format that is cool that will actually speed up my ability to use the script [3:20 PM]
Jennifer Pearl: I want to get the hang of JSON files though [3:20 PM]
LFP6: I just need to add the ability to get current puzzle [3:21 PM]
LFP6: *puzzles [3:21 PM]
Jennifer Pearl: that is a feature i am looking forward to very much [3:22 PM]
Jennifer Pearl: i have big plans for that [3:23 PM]
LFP6: Lemme do that, and I'll put it up [3:22 PM]
Jennifer Pearl: if you can get it befor the lab submission deadline that would be amazing [3:23 PM]
LFP6: I can do it tonight [3:23 PM]
Jennifer Pearl: a thankgiving miricale [3:23 PM]
LFP6: Thanks to lack of school :D [3:23 PM]
Jennifer Pearl: yay no school!!!!!!!!!!! [3:24 PM]
Jennifer Pearl: bet you enjoyed that [3:24 PM]
Elves: hi folks i lost interwebz. [3:24 PM]
Jennifer Pearl: hi Elves welcome back. Glad the system of tubes brought you back here [3:25 PM]
whbob: @ Jen: I mod'd several players designs and saw that Ensemble Defect was very low in some of the better players designs. [3:25 PM]
LFP6: Yeah, nice extra 3 days off :) [3:24 PM]
Elves: thanks :D [3:25 PM]
Jennifer Pearl: @whbob that sounds like it tracks with what I have seen [3:25 PM]
Elves: hi LFP6! glad you could make it [3:25 PM]
LFP6: Hey! [3:25 PM]
Jennifer Pearl: with my experiecne with Ensemble Diversity the good designs had values of 5 to 15 [3:26 PM]
LFP6: And promptly, I must head to dinner :P [3:25 PM]
Elves: ahaha enjoy! [3:26 PM]
LFP6: I'll be back in a bit to finish the script Jen, shouldn't take a ton of time [3:26 PM]
LFP6: afk [3:26 PM]
Jennifer Pearl: I am not sure how that translates to nupack yet [3:27 PM]
Jennifer Pearl: by LFP6 [3:27 PM]
Jennifer Pearl: thanks and see you later [3:27 PM]
whbob: I read a paper recently that showed graphically that Diversity and Defect tracked the same for the same design. [3:28 PM]
Elves: Jen shall we walk through submitting a mod in current labs, with the information & hashtag label for the ensemble defect experiment? [3:28 PM]
Jennifer Pearl: cool would like to read it [3:28 PM]
Jennifer Pearl: sure [3:28 PM]
whbob: Not the same numbers but both low or high. [3:29 PM]
Jennifer Pearl: that makes sense. I saw some of the real bad designs that scored 30 with ridiculously high ensemble defect [3:30 PM]
Jennifer Pearl: I'll ket you lead the way elves. I have not done a submission in a very long time. [3:31 PM]
Jennifer Pearl: or i can fumble thorugh it if you want [3:31 PM]
Jennifer Pearl: been coding tooooooo much [3:31 PM]
John Cook: Hi [3:31 PM]
Jennifer Pearl: hi John [3:32 PM]
whbob: Hi John [3:32 PM]
Elves: hi John welcome back! [3:32 PM]
Elves: hey Jen, I'm learning as well since labs are so different, but that's partly why I am excited to get through an actual submission [3:32 PM]
John Cook: Sorry, I'm late. I just have a minute, but I wanted to pop in. [3:32 PM]
Jennifer Pearl: nice glad to have you here [3:33 PM]
Elves: also i think it will help people see how to use hashtags and use the tools for measuring ensemble defect that we introduced at last dev chat [3:32 PM]
Jennifer Pearl: yes. [3:33 PM]
Elves: Hi John, no worries, you're welcome as long as you like [3:33 PM]
Jennifer Pearl: I do not have lightscribe installed on my computer so if you can work that magic I can discuss what to do [3:33 PM]
Elves: we're going to take a quick walkthrough in the active labs and see if we can complete a submission, and if we have time also take a look at the ensemble defect tool [3:33 PM]
Elves: sure, fortunately we have a mod walkthrough already in the wiki, complete with prepared screenshots [3:33 PM]
Jennifer Pearl: nice lets follow that [3:34 PM]
Jennifer Pearl: can you share a link [3:34 PM]
Elves: http://eternawiki.org/wiki/index.php5/2015.10.30_Community_Chat [3:34 PM]
Elves: starting at 15:05 [3:34 PM]
Elves: i'll just paste in instructions here to make it easier [3:35 PM]
Elves: let's go check out the active labs using the top menu http://prntscr.com/8x82uh [3:35 PM]
John Cook: If you know someone's username, is there a way to look up their profile so you can DM them? [3:35 PM]
Elves: you can click on the name in the chat window [3:35 PM]
Elves: let's go check out the active labs using the top menu http://prntscr.com/8x82uh [3:35 PM]
Jennifer Pearl: yes. Click on Community and then on players [3:35 PM]
Elves: oops copy paste fail [3:35 PM]
Elves: that will bring you to this page: http://www.eternagame.org/web/labs/ [3:35 PM]
Jennifer Pearl: you can type in there name and find them [3:36 PM]
John Cook: Thanks Jennifer, that is exactly what I was looking for. [3:36 PM]
Elves: scroll down to click Participate, and see how to make our own mods. [3:36 PM]
Jennifer Pearl: great [3:37 PM]
Elves: http://prntscr.com/8x839i [3:36 PM]
Elves: That will take you to this current active lab, and in future lab rounds this page will be different: http://www.eternagame.org/web/lab/6204762/ [3:37 PM]
Elves: When you scroll down you will see multiple challenges. Today let's do the first design challenge. Right click on the Vote button to open player submitted designs in a new tab [3:37 PM]
Jennifer Pearl: so what sublab shouel we do. [3:37 PM]
Elves: http://prntscr.com/8x8416 [3:37 PM]
Elves: the first one [3:37 PM]
whbob: You wll see a design that I did recently [3:39 PM]
Jennifer Pearl: MS2 control on? [3:38 PM]
Elves: what do you mean? [3:39 PM]
Jennifer Pearl: That is the name of the fist sublab [3:39 PM]
Elves: yes! [3:39 PM]
Jennifer Pearl: cool [3:40 PM]
Elves: Now let's go back to the first tab and click on the first challenge's Design button to launch the sequence designer for creating your submission. [3:40 PM]
Elves: http://prntscr.com/8x84bv [3:40 PM]
Jennifer Pearl: sounds fun. It is a single state puzzle [3:40 PM]
Elves: also go ahead and open a text editor for copy pasting [3:40 PM]
Elves: You should now have three windows open - your text editor, the list of player designs, and the window for designing your own submission. [3:41 PM]
Elves: Now let's go to the Vote for Player Designs window, where there is a full list of submitted designs to choose from. [3:41 PM]
Elves: http://prntscr.com/8x81se [3:41 PM]
Elves: the top one for me is indeed whbob, great work submitting!! [3:41 PM]
whbob: Thanks, looks like you are in the R2 sublab [3:42 PM]
Elves: aha thanks. looks like more sublabs were added and got sorted first [3:43 PM]
Elves: ok i'm going to go back to the lab page and pick R2 since that is the screenshots walkthrough we did before [3:44 PM]
Elves: http://prntscr.com/97rc9u [3:44 PM]
Elves: http://www.eternagame.org/game/browse/6204761/ [3:44 PM]
Elves: http://www.eternagame.org/game/puzzle/6204761/ [3:44 PM]
Elves: those two links are the voting list and the design page for R2 [3:44 PM]
Elves: not MS2 control on, which is a new sublab [3:45 PM]
Elves: hmm [3:46 PM]
John Cook: While you folks are talking about the labs. I am currious about all those fields in the voting area and how one might use them to vote. Is there any method to doing this? Does anyone have a better eye for what might actually synthisize? Or is it really just dumb luck? [3:47 PM]
Jennifer Pearl: sounds good [3:47 PM]
Elves: hi john, voting is essentially unecessary at this stage [3:47 PM]
Elves: making molecules and getting back data will tell us what synthesizes [3:47 PM]
Elves: so it may be luck, if you can find a method that is reproducible you can define and enter it into the strategy market in the forum [3:48 PM]
Elves: here's a link to just one design from that list for easy access [3:49 PM]
Elves: http://www.eternagame.org/game/browse/6204761/?filter1_arg1=6278119&filter1_arg2=6278119&filter1=Id [3:49 PM]
Jennifer Pearl: we hope toi find patterns in teh results that can show us what to use to make good designs [3:50 PM]
Elves: In your text editor write down the name of the lab and author, A before B before MS2 2 (Eli Fisker). [3:50 PM]
Elves: click on the design, and a popup window will come up with a View/Copy button [3:51 PM]
Elves: click on that button [3:51 PM]
Elves: http://prntscr.com/8x7vfr [3:52 PM]
Elves: To copy the sequence, click on the Options button and click Copy to copy the sequence of nucleotides for this design to your clipboard. [3:52 PM]
Elves: http://prntscr.com/8x80mu [3:52 PM]
Elves: http://prntscr.com/8x7zwg [3:52 PM]
Elves: also copy the URL into the text editor [3:53 PM]
Elves: then click copy for the sequence [3:54 PM]
Elves: and to the Design tab that you have open from before, and paste it in there. [3:54 PM]
John Cook: Thanks Elves. Why is voting not important? Does everything get sythesised? [3:54 PM]
Elves: *go [3:54 PM]
Elves: John when a lab has slots fill up then votes do determine what gets synthesized, but our throughput is so high currently that it is not as much of a challenge as before to get a spot [3:54 PM]
Elves: as more people join, that may become a strategy for getting synth slots again, but for now you can enjoy focusing on design and not worry about votes. [3:55 PM]
Jennifer Pearl: when we first started we could only synth about 7 designs at a time per week /month [3:55 PM]
Jennifer Pearl: what is the next step Elves? [3:57 PM]
Elves: You can paste by clicking on the options button, and then click Paste [3:57 PM]
Elves: http://prntscr.com/8x7y0x [3:57 PM]
Elves: A window will pop up where you can click in the text field and press ctrl+v / cmd+v and paste the sequence in. [3:58 PM]
Elves: after you go back to the design tab [3:58 PM]
Elves: http://prntscr.com/8x7zgo [3:58 PM]
Elves: http://www.eternagame.org/game/puzzle/6204761/ [3:58 PM]
Elves: so the workflow at this point is, open up active labs [3:58 PM]
Elves: pick a lab design from another player [3:58 PM]
Elves: copy the sequence onto your clipboard [3:58 PM]
Elves: open up the design tab for the same lab [3:59 PM]
Elves: ( sublab ) [3:59 PM]
Elves: and paste in the sequence [3:59 PM]
Elves: at this point you will have a design that fully validates against the requirements for that lab, without having to know all the specifics [3:59 PM]
Elves: however this is not enough to submit [3:59 PM]
Elves: because you must still find a unique sequence [3:59 PM]
Elves: http://prntscr.com/8x8cxh [4:00 PM]
Elves: Try selecting one color, and mutating one nucleotide at a time. [4:00 PM]
Elves: http://prntscr.com/8x8dsu [4:00 PM]
Elves: You can press the letter z to undo and go backwards if it didn't work out. [4:00 PM]
Elves: http://prntscr.com/8x8eg2 [4:00 PM]
Elves: In the previous example I changed nucleotide 83 from red guanine to yellow adenine and it didn't like it. [4:00 PM]
Elves: But I can change nucleotide 9 from blue uracil to yellow adenine and it's just fine. [4:00 PM]
Elves: Keeping track of the specific mods that you make will be great for the description, but don't worry if you don't track them all, since as long as you copy in the source info, the sequences can always be compared. [4:00 PM]
Elves: Once you have made the mods you want it's time to try publishing your solution, and see if you found a unique sequence! [4:01 PM]
Elves: so at this stage we have two more steps to complete: 1) come up with a unique sequence that does not turn any of the constraint boxes red [4:01 PM]
Elves: 2) to participate in the ensemble defect experiment, we will submit the sequence to a tool that will tell us additional notes to put in the publishing description [4:02 PM]
Elves: along with a hashtag note [4:02 PM]
Elves: so that we can easily identify which lab submissions have this info [4:02 PM]
Elves: so the first thing to do is solve for a unique sequence [4:02 PM]
Elves: in the interest of time, I'm just going to find one, that may or may not be unique, and then Jen and I can walk everyone through that second step [4:03 PM]
Elves: Jen could you please get that link to the tool prepared while I get a sequence together? [4:03 PM]
Jennifer Pearl: ok. I found it. [4:04 PM]
Jennifer Pearl: Do you want me to post now [4:04 PM]
Elves: here is the publish button http://prntscr.com/8x8hdh [4:04 PM]
Elves: yes please, thanks! [4:04 PM]
Jennifer Pearl: http://www.nupack.org/utilities/ [4:05 PM]
Jennifer Pearl: here is a link to a document describing the process we are about ot go through [4:05 PM]
Jennifer Pearl: https://dl.dropboxusercontent.com/u/87351147/How%20so%20find%20ensemble%20defect%20with%20NUPACK.pdf [4:05 PM]
Elves: to get the info for the publishing description, first copy the finished sequence into the clipboard, [4:05 PM]
Elves: and then go to the first link from jen above, nupack.org/utilities [4:06 PM]
Elves: GUCGACUCACAGCUCAGAAAACUGAGUUGAGUGUUGACAAACUUAUUCUUUGAGUGGGACAUGAGGAUCACCCAUGUUAAAGGGA [4:06 PM]
Elves: I don't know if this one will be unique, and certainly it will only work for one of us, but Jen go ahead and use that sequence for this example [4:06 PM]
Elves: it's as I described above, where I mutated only one nucleotide [4:06 PM]
Elves: changing 9 to adenine [4:07 PM]
Elves: from uracil [4:07 PM]
Jennifer Pearl: ok we also need the sequence of the oligos [4:07 PM]
Jennifer Pearl: but we can get the state without any oligos present with just this [4:07 PM]
Elves: awesome, Jen please walk us through getting the info we need to put into the publish description to submit to the ensemble defect experiment [4:08 PM]
Jennifer Pearl: wait that is a math desing [4:09 PM]
Elves: ? [4:09 PM]
whbob: I checked MFE and posted teh sequence into the box [4:11 PM]
whbob: In NUPACK [4:11 PM]
Jennifer Pearl: it deals with concentrations of TB-A to TB-B [4:11 PM]
Jennifer Pearl: i am not sure how to do that in nupack [4:11 PM]
Jennifer Pearl: yet [4:11 PM]
whbob: after the sequence is pasted to the box [4:12 PM]
Elves: whbob that is what the guide says! Jen can you please confirm that is correct? [4:12 PM]
whbob: Press ENTER [4:12 PM]
whbob: That brings up the shape structure. [4:13 PM]
Jennifer Pearl: yes. but you also need to know the sequence of the oligos [4:13 PM]
whbob: Once the structure appears, click on update in the upper right hand corner [4:13 PM]
Jennifer Pearl: i think i left that out of the document [4:13 PM]
Jennifer Pearl: on accident [4:13 PM]
Elves: jen where do you input the sequence of oligos? [4:13 PM]
Jennifer Pearl: so the document only works for states without an oligo present [4:14 PM]
Jennifer Pearl: at the end of the main sequence put a + [4:14 PM]
Jennifer Pearl: and then the oligo [4:14 PM]
Jennifer Pearl: so for example "AUGGUG+AUGU" [4:14 PM]
Elves: and do we have the oligo sequence easily available? [4:14 PM]
Jennifer Pearl: not really [4:15 PM]
Jennifer Pearl: I had to look at it and write it down [4:15 PM]
Elves: do we read it from lowest nucleotide number to highest? [4:15 PM]
Jennifer Pearl: yes [4:15 PM]
Elves: and it's ok if there are two as in this example? [4:15 PM]
Jennifer Pearl: should be [4:16 PM]
Jennifer Pearl: just use two +'s [4:16 PM]
Jennifer Pearl: one for each oligo [4:16 PM]
Elves: ACCCCACAAUAAAGAAUAAG [4:16 PM]
Elves: IS THE FIRST ONE [4:16 PM]
Elves: oops [4:16 PM]
Elves: :D [4:16 PM]
whbob: Sorry Jen, all of my calculatuions are without oligo's:( [4:18 PM]
Elves: CUGAUCCCAUCUCACUC [4:18 PM]
Elves: is the second one [4:18 PM]
Jennifer Pearl: that is ok. [4:18 PM]
Elves: if anyone wants to double check? [4:18 PM]
Jennifer Pearl: ill check real quick [4:20 PM]
Elves: okay [4:19 PM]
Elves: i double checked [4:20 PM]
Elves: so you would add this to the end of the sequence +ACCCCACAAUAAAGAAUAAG+CUGAUCCCAUCUCACUC [4:20 PM]
Elves: and then click update [4:20 PM]
Jennifer Pearl: yes [4:21 PM]
Jennifer Pearl: the sequence look good [4:21 PM]
Elves: http://prntscr.com/97rpgo [4:21 PM]
Elves: and normalized ensemble defect is 8.4% [4:21 PM]
Elves: http://prntscr.com/97rpnq [4:22 PM]
Elves: without the oligos i think it was closer to 27% or something which is way different! :D [4:22 PM]
whbob: The two oligo's, in this case, drops the Defect number to 1/3 the value without the oligo's. [4:23 PM]
Elves: now go ahead and paste the ensemble defect in your text editor as well [4:23 PM]
Jennifer Pearl: I got 9.21 [4:24 PM]
Jennifer Pearl: 9.1 [4:24 PM]
Elves: hmm that is interesting! [4:24 PM]
Elves: did you paste in the sequence i put in chat or the original one [4:24 PM]
Elves: i changed one nucleotide [4:24 PM]
Elves: for the base sequence [4:24 PM]
Elves: not oligos [4:24 PM]
Jennifer Pearl: 8.4 [4:25 PM]
Jennifer Pearl: was short a nuc [4:25 PM]
Elves: ahaha what a difference on nucleotide can make!! [4:25 PM]
Elves: okay cool! [4:26 PM]
Elves: also go ahead and paste #EnsembleDefect into the text editor [4:26 PM]
Elves: at minimum you will now have this: [4:26 PM]
Elves: A before B before MS2 2 (Eli Fisker). [4:26 PM]
http://www.eternagame.org/game/browse/6204761/?filter1_arg1=6278119&filter1_arg2=6278119&filter1=Id
normalized ensemble defect is 8.4%
#EnsembleDefect
Elves: the name of the mod, the url, the ensemble defect %, and the hashtag [4:27 PM]
Elves: now when you click to publish your design, assuming you found a unique sequence, you can create a title like "Mod of... " [4:27 PM]
Elves: and enter that info from your text editor into the description field [4:27 PM]
Jennifer Pearl: i think that all teh very high ensemble defect desings will score porrly and the low ranged one will fair better [4:27 PM]
Jennifer Pearl: or at least have designs that fair better only in that lower range [4:28 PM]
Elves: and publish description is actually "Comment" http://i.imgur.com/s5OqBuk.png [4:30 PM]
whbob: Well done. [4:31 PM]
Elves: :D [4:31 PM]
Elves: thanks for walking through this together everybody! [4:31 PM]
Elves: omg i actually submitted a lab. woohoo! now the next one will be easier [4:31 PM]
whbob: Thank you Elves, Jen. [4:32 PM]
Jennifer Pearl: np [4:32 PM]
Jennifer Pearl: have a good weekend [4:32 PM]
Elves: and of course it is a huge help if you can design unique sequences from scratch but this is totally fine as a learning strategy [4:32 PM]
Elves: since the learning curve is so steep [4:32 PM]
Elves: Thank you Jen! [4:32 PM]
Elves: especially for helping us learn how to use the nupack tool to measure ensemble defect [4:32 PM]
Jennifer Pearl: it was fun [4:33 PM]
Elves: and it's cool that devs implemented ability to pull out hashtag categories from lab descriptions [4:32 PM]
Jennifer Pearl: yes very much [4:33 PM]
Elves: i hope this will make it easier for everyone to come up with and test out new experiments [4:33 PM]
Elves: This lab ends on Nov. 30th, so make the most of this walkthrough tutorial and try it out before then. And even afterwards, the basic prinicples will still apply. [4:33 PM]
Elves: thanks everybody! [4:33 PM]
Elves: have an awesome weekend!! [4:33 PM]
Jennifer Pearl: you too [4:34 PM]
whbob: Ditto! afk [4:35 PM]
Jennifer Pearl: back to coding [4:34 PM]
Elves: hehehe enjoy!!! [4:34 PM]
