User talk:ElNando888/Self-interacting sequences

== Documented candidates ==

=== Candidate 1 ===

==== Raw data ====

Sequence	`AAGUGAACUAUGGGAGCCCUGGGAGGCUCCUCCUGCUGUUCCCAGACAGCAAAAGCCUGUUGG`
MFE (Vienna 2.1.1)	`..........(((((((..((((((....))))))..)))))))..(((((......))))).`	-21.7
Fully constrained	`..................xxxxxx...............xxxxxx..................` `...........(((((((......)))))))..((((((......))))))............`	-19.4
Constraint hairpin 1	`..................xxxxxx.......................................` `...........(((((((......)))))))..(((((((....)))))))............`	-20.5
Constraint hairpin 2	`.......................................xxxxxx..................` `...........(((((((......)))))))..((((((......))))))............`	-19.4
Hairpins seq. paired	`..................((((((...............))))))..................` `..................(((((((((.......)))..)))))).(((((......))))).`	-15.8

==== 2D and 3D shots ====

(coming soon)

==== Comments ====

The delta between the MFE and the hairpins form is both low (hopefully helping the targeted 'pseudo-switching' behavior) and large enough to make it clear that the experiment failed if the 'pseudo-switching' should not occur at all.
The formation of either of the hairpins (and its possible kissing complex forming) should result in the other hairpin forming as well.
The form with the hairpin sequences forming a stack is comparatively unlikely (high kcal delta)

== Other examples ==

(need re-analysis)

=== Candidate 1 ===

Sequence	`AAACAGUUGGCUUGAGCCCUGGGAGGCUCUGAGGCUGUUCCCAGACAGCUGAGGGUGGCCAUC`
MFE (Vienna 2.1.1)	`.......(((((...(((((.((..(.((((.((.....)))))))..)).))))))))))..`
Constrained folding	`.......(((((..((((......))))((..((((((......))))))..))..)))))..`

Coaxial stacking predicted for the constrained form:

=== Candidate 2 ===

Sequence	`AUGCUUCCCCUGGGAGCCCUGGGAGGCUCACAGGCUGUUCCCAGACAGCACGGCAAAUAAGGU`
MFE (Vienna 2.1.1)	`.((((....((((((((((((.........))))..))))))))..)))).............`
Constrained folding	`.((((....(((.(((((......))))).)))(((((......)))))..))))........`

=== Candidate 3 ===

Sequence	`AGUAAUCGAAUAUGAGCCCUGGGAGGCUCUGUUGCUGUUCCCAGACAGCGUCCCUGGCUCUAG`
MFE (Vienna 2.1.1)	`.............(((((..((((.((((((..........))))..)).)))).)))))...`
Constrained folding	`........((((.(((((......)))))))))(((((......)))))..............`

=== Candidate 4 ===

Sequence	`GCGAAGGGAUAAUGAGCCCUGGGAGGCUCCUUGGCUGUUCCCAGACAGCAAAAUGAGUAUUUU`
MFE (Vienna 2.1.1)	`((...((((.....((((..((((...)))).))))..)))).....))..............`
Constrained folding	`.........(((.(((((......))))).)))(((((......)))))..............`

=== Candidate 5 ===

Sequence	`CGUCCCGCUUGUCGAGCCCUGGGAGGCUCUGGCGCUGUUCCCAGACAGCUGUCCCAUGGAAUG`
MFE (Vienna 2.1.1)	`......((((...))))(((((((((((((((........)))))..))).))))).))....`
Constrained folding	`..........((((((((......))))).)))(((((......)))))..(((...)))...`

Coaxial stacking predicted for the constrained form:

=== Candidate 6 ===

Sequence	`UUAAGAACCGAGGGAGCCCUGGGAGGCUCGGUCUGCUGUUCCCAGACAGCCGUAGAAAGAAAC`
MFE (Vienna 2.1.1)	`.......((.(((....))).))...(((((.((((((....))).)))))).))........`
Constrained folding	`...(((.((....(((((......))))))))))(((((......))))).............`

Coaxial stacking is not predicted to occur, but the hairpins (marked in white) seem to be predicted to stay distant from each other.

Start a discussion about User:ElNando888/Self-interacting sequences

Talk pages are where people discuss how to make content on Eterna Wiki the best that it can be. You can use this page to start a discussion with others about how to improve User:ElNando888/Self-interacting sequences.

Start a discussion