Suboptimal Structure

From Eterna Wiki

Revision as of 08:47, 22 June 2022 by Anamfija (talk | contribs) (Update category and formatting)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Suboptimal structures (also called alternative structures) are structures that a given sequence could fold into aside from the minimum free energy structure. As an RNA folds, it may pass through several suboptimal structures before it adopts a stable structure. These alternative structures may also exist in chemical equilibrium with one another and with the MFE structure.

Example

The following examples show two suboptimal structures and the minimum free energy structure for the sequence:

GGAAACCGCCCGCGCGGGCGCGGGCGAAAACGCCCGCGAAACCGCCGCGAAAACGCGGCGGCCCGCGCGGGCGGAAAAGAAACAACAACAACAAC

Suboptimal structure #1

Notice that the second suboptimal structure has a rather low value of free energy. Many stable GC pairs would have to be broken in order to bring this from the second suboptimal structure to the minimum free energy structure.

Suboptimal structure #2



MFE structure

This is one of the several downsides of "christmas tree" designs in lab.