View source for Puzzle Walkthroughs/Basic Switch Walkthrough (chatlog)

<p>Chat log captured on Dec 24<sup>th</sup> 2012</p>
<table border="0" cellpadding="3">
<tr>
<td>&nbsp;</td>
<td>&nbsp;</td>
</tr>
<tr>
<td>Kalas</td>
<td>Am I the only one having trouble with [[switch]]es?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>kalas,... join the club</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>:)</td>
</tr>
<tr>
<td>Quxwozing</td>
<td>yeah</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>Based on the number of solvers on most switch [[puzzle]]s, Ii believe it to be a very large club of us mere mortal solvers...</td>
</tr>
<tr>
<td>Kalas</td>
<td>Never paid attention, I'll take a look. ;-)</td>
</tr>
<tr>
<td>jmf028</td>
<td>i'm not one of em :)</td>
</tr>
<tr>
<td>jmf028</td>
<td>mere mortals i mean</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>jmf, you're too humble...</td>
</tr>
<tr>
<td>jmf028</td>
<td>:D</td>
</tr>
<tr>
<td>jmf028</td>
<td>sorry</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>jmf, when are you going to do a guide for solving switches</td>
</tr>
<tr>
<td>jmf028</td>
<td>merry christmas</td>
</tr>
<tr>
<td>jmf028</td>
<td>as soon as i finish this switch</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>cool</td>
</tr>
<tr>
<td>jmf028</td>
<td>if you want I can show you right now</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>\</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>cool</td>
</tr>
<tr>
<td>jmf028</td>
<td>id rather not make a written guide</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>understand</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay so lets start with [http://eterna.cmu.edu/web/puzzle/877668/ basic switch] first</td>
</tr>
<tr>
<td>jmf028</td>
<td>have you solved that yet?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>ok</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>yeah, I actually have 4 or 5 solved. and another 4 close.</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>my problem is I get close, and can't figure how to finish</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay well lets go to one you haven't tried yet</td>
</tr>
<tr>
<td>jmf028</td>
<td>ill guide you through how i solve it</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>perfect</td>
</tr>
<tr>
<td>jmf028</td>
<td>and don't pick the jet plane or the only 13 solved ones</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>:D wouldn't do that</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay tell me when you found one</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>actually, can you give me a hint on how I would go about getting this one completed</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356385525.png</td>
</tr>
<tr>
<td>jmf028</td>
<td>alright hold on</td>
</tr>
<tr>
<td>Kalas</td>
<td>hey</td>
</tr>
<tr>
<td>Kalas</td>
<td>I could use a hand here too</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>I think I have 3 that are about this close... I get to here and can;t figure out. Kalas: CUGAGGAUAUGGAAAACUAGAAGGCGGCACACACACAACACCU</td>
</tr>
<tr>
<td>Kalas</td>
<td>uhghh</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>sorry kalas, good point, we should</td>
</tr>
<tr>
<td>Kalas</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356385575.png</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>lets do one from the start so this isn't so one sided.</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>my mistake, sorry kalas</td>
</tr>
<tr>
<td>jmf028</td>
<td>oh i see</td>
</tr>
<tr>
<td>jmf028</td>
<td>ok lets go to that one</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>ok</td>
</tr>
<tr>
<td>jmf028</td>
<td>alright ready guys?</td>
</tr>
<tr>
<td>Kalas</td>
<td>Yep</td>
</tr>
<tr>
<td>Kalas</td>
<td>I am</td>
</tr>
<tr>
<td>Kalas</td>
<td>;-)</td>
</tr>
<tr>
<td>jmf028</td>
<td>cool alright so first we fill in the locked [[base]]s partners</td>
</tr>
<tr>
<td>jmf028</td>
<td>start with locked [[Adenine]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356385708.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 1.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>should look like that</td>
</tr>
<tr>
<td>Kalas</td>
<td>ahhh</td>
</tr>
<tr>
<td>jmf028</td>
<td>the reason this is the first base you start filling in is because it is the only possible [[Base Pair|pair]] you can make with a locked Adenine</td>
</tr>
<tr>
<td>Kalas</td>
<td>So i need to do it over again?</td>
</tr>
<tr>
<td>jmf028</td>
<td>now</td>
</tr>
<tr>
<td>jmf028</td>
<td>yes kalas</td>
</tr>
<tr>
<td>Kalas</td>
<td>ok</td>
</tr>
<tr>
<td>Kalas</td>
<td>sad</td>
</tr>
<tr>
<td>Kalas</td>
<td>give me a sec</td>
</tr>
<tr>
<td>jmf028</td>
<td>if you want to follow this guide correctly</td>
</tr>
<tr>
<td>Kalas</td>
<td>done</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>me too</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay so now, do you know how to highlight a base?</td>
</tr>
<tr>
<td>Kalas</td>
<td>no</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>yes</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>control click</td>
</tr>
<tr>
<td>jmf028</td>
<td>hold cntrl for pc and command for mac and click on base</td>
</tr>
<tr>
<td>jmf028</td>
<td>click on the [[Uracil|U]] you just filled in</td>
</tr>
<tr>
<td>Kalas</td>
<td>k</td>
</tr>
<tr>
<td>jmf028</td>
<td>is it highlighted with black circle?</td>
</tr>
<tr>
<td>Kalas</td>
<td>yes</td>
</tr>
<tr>
<td>jmf028</td>
<td>good</td>
</tr>
<tr>
<td>jmf028</td>
<td>now</td>
</tr>
<tr>
<td>jmf028</td>
<td>switch to other structure</td>
</tr>
<tr>
<td>Kalas</td>
<td>Im doing it in PiP</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356385920.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 2.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>oh well then don't</td>
</tr>
<tr>
<td>Kalas</td>
<td>i see it</td>
</tr>
<tr>
<td>jmf028</td>
<td>you need to have this one as it allows you to highlight</td>
</tr>
<tr>
<td>jmf028</td>
<td>otherwise you will have to highlight both structures</td>
</tr>
<tr>
<td>Kalas</td>
<td>okay, i'll do that</td>
</tr>
<tr>
<td>jmf028</td>
<td>don't get me wrong sometimes PiP mode is necessary</td>
</tr>
<tr>
<td>Kalas</td>
<td>you're right</td>
</tr>
<tr>
<td>jmf028</td>
<td>but for now lets keep it simple</td>
</tr>
<tr>
<td>Kalas</td>
<td>okay</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay so the U is in a loop right?</td>
</tr>
<tr>
<td>Kalas</td>
<td>yup</td>
</tr>
<tr>
<td>jmf028</td>
<td>in this case no pair is to be had in this structure with that U</td>
</tr>
<tr>
<td>jmf028</td>
<td>so......</td>
</tr>
<tr>
<td>jmf028</td>
<td>unhighlight</td>
</tr>
<tr>
<td>jmf028</td>
<td>XD</td>
</tr>
<tr>
<td>jmf028</td>
<td>not a word but whatevs</td>
</tr>
<tr>
<td>Kalas</td>
<td>Following instructions</td>
</tr>
<tr>
<td>jmf028</td>
<td>switch back</td>
</tr>
<tr>
<td>jmf028</td>
<td>now we will fill in bases next to locked [[Guanine|G]]s</td>
</tr>
<tr>
<td>Kalas</td>
<td>ok</td>
</tr>
<tr>
<td>jmf028</td>
<td>do you understand why Gs are a little different than As</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>yep 2 choices</td>
</tr>
<tr>
<td>jmf028</td>
<td>gj rnj</td>
</tr>
<tr>
<td>Kalas</td>
<td>A only match with U?</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct</td>
</tr>
<tr>
<td>jmf028</td>
<td>well here is my solution</td>
</tr>
<tr>
<td>jmf028</td>
<td>dont worry about choice right now</td>
</tr>
<tr>
<td>jmf028</td>
<td>only use GCs</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>makes sense</td>
</tr>
<tr>
<td>Kalas</td>
<td>To keep 1 choice</td>
</tr>
<tr>
<td>jmf028</td>
<td>so next to Each one, use a [[Cytosine|C]]</td>
</tr>
<tr>
<td>Kalas</td>
<td>done</td>
</tr>
<tr>
<td>jmf028</td>
<td>and then highlight both</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>done</td>
</tr>
<tr>
<td>jmf028</td>
<td>then switch</td>
</tr>
<tr>
<td>Kalas</td>
<td>done</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386202.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 3.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>should look like this so far</td>
</tr>
<tr>
<td>Kalas</td>
<td>yup</td>
</tr>
<tr>
<td>jmf028</td>
<td>good</td>
</tr>
<tr>
<td>jmf028</td>
<td>switch back</td>
</tr>
<tr>
<td>Kalas</td>
<td>done</td>
</tr>
<tr>
<td>jmf028</td>
<td>now usually when no more locked bases, you have to guess</td>
</tr>
<tr>
<td>jmf028</td>
<td>but here is my strategy</td>
</tr>
<tr>
<td>jmf028</td>
<td>[[GC Pair|GC]]s at [[loop]]-[[stack]] intersections</td>
</tr>
<tr>
<td>jmf028</td>
<td>[[AU Pair|AU]]s between loops</td>
</tr>
<tr>
<td>jmf028</td>
<td>so check this out</td>
</tr>
<tr>
<td>Kalas</td>
<td>thats my strat so far</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>do you have a preference on orientation GC or CG</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386327.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 4.png]]&nbsp;</td>
</tr>
<tr>
<td>Kalas</td>
<td>follow the locked pattern</td>
</tr>
<tr>
<td>jmf028</td>
<td>in this case</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>what I have</td>
</tr>
<tr>
<td>jmf028</td>
<td>this is the best [[energy]] orientation for the puzzle</td>
</tr>
<tr>
<td>jmf028</td>
<td>so far.....</td>
</tr>
<tr>
<td>jmf028</td>
<td>so</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>agreed</td>
</tr>
<tr>
<td>jmf028</td>
<td>now you have to highlight both bases in each pair</td>
</tr>
<tr>
<td>jmf028</td>
<td>switch then</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386394.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 5.png]]&nbsp;&nbsp;</td>
</tr>
<tr>
<td>jmf028</td>
<td>should look like this</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>let me guess, the next step is to put a G in 2</td>
</tr>
<tr>
<td>jmf028</td>
<td>yep exactly :)</td>
</tr>
<tr>
<td>jmf028</td>
<td>but here is where you start having fun</td>
</tr>
<tr>
<td>Kalas</td>
<td>g in 2?</td>
</tr>
<tr>
<td>jmf028</td>
<td>once you put the G there, switch highlighted C to to the G you just put</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>yep, Up to this point I am good... it is from here...</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>Kalas, next to the circled C</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356386503.png</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct</td>
</tr>
<tr>
<td>Kalas</td>
<td>oh</td>
</tr>
<tr>
<td>Kalas</td>
<td>ok</td>
</tr>
<tr>
<td>jmf028</td>
<td>but remember to switch the highlighted portion from the C to the G and from the U to the already bonded A</td>
</tr>
<tr>
<td>jmf028</td>
<td>and unhighlight the A and G in the loop</td>
</tr>
<tr>
<td>jmf028</td>
<td>then switch</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386581.png</td>
</tr>
<tr>
<td colspan="2">&nbsp;[[File:Basic switch walkthrough chatlog 6.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>should look like this</td>
</tr>
<tr>
<td>Kalas</td>
<td>indeed</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>yep</td>
</tr>
<tr>
<td>jmf028</td>
<td>unhighlight those two bases now, and you have all the bases paired in one structure now</td>
</tr>
<tr>
<td>jmf028</td>
<td>now lets work on the other structure</td>
</tr>
<tr>
<td>jmf028</td>
<td>switch</td>
</tr>
<tr>
<td>jmf028</td>
<td>there are three still unpaired bases in this puzzle</td>
</tr>
<tr>
<td>Kalas</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356386666.png</td>
</tr>
<tr>
<td>jmf028</td>
<td>so remember what i said about intersections and in between the loops?</td>
</tr>
<tr>
<td>Kalas</td>
<td>Yes</td>
</tr>
<tr>
<td>jmf028</td>
<td>EXACTLY</td>
</tr>
<tr>
<td>jmf028</td>
<td>good job</td>
</tr>
<tr>
<td>jmf028</td>
<td>how does the other one look?</td>
</tr>
<tr>
<td>Kalas</td>
<td>bad XD</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay well hold on</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386728.png</td>
</tr>
<tr>
<td colspan="2">&nbsp;&nbsp;[[File:Basic switch walkthrough chatlog 7.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>here is a good structure that keeps the first one stable</td>
</tr>
<tr>
<td>jmf028</td>
<td>this is not stable</td>
</tr>
<tr>
<td>jmf028</td>
<td>but it is all paired</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>agreed</td>
</tr>
<tr>
<td>jmf028</td>
<td>all 6 of the base pairs need to be highlighted and paired up in other structure</td>
</tr>
<tr>
<td>jmf028</td>
<td>but since other structure is stable, it looks like they already are :)</td>
</tr>
<tr>
<td>jmf028</td>
<td>also, when switched again:</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>so now we need to deal with energy of the structures w/ and w/o the molecule</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386835.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 8.png]]<br /></td>
</tr>
<tr>
<td>jmf028</td>
<td>notice the G that just so conveniently fell into the [[Boosting|boost]] base near the GC at loop</td>
</tr>
<tr>
<td>Kalas</td>
<td>yes</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>was just looking at that</td>
</tr>
<tr>
<td>jmf028</td>
<td>:)</td>
</tr>
<tr>
<td>jmf028</td>
<td>that is not always what happens</td>
</tr>
<tr>
<td>jmf028</td>
<td>but still it is good XD</td>
</tr>
<tr>
<td>jmf028</td>
<td>unhighlight all the bases and now we are on to the switching back and forth part</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>k</td>
</tr>
<tr>
<td>jmf028</td>
<td>now lets go to the unstable structure</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356386985.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 9.png]]<br /></td>
</tr>
<tr>
<td>jmf028</td>
<td>notice the end loop has no boost G</td>
</tr>
<tr>
<td>Kalas</td>
<td>indeed</td>
</tr>
<tr>
<td>jmf028</td>
<td>lets try inserting one and see what it does to brother structure</td>
</tr>
<tr>
<td>Kalas</td>
<td>makes it unstable</td>
</tr>
<tr>
<td>jmf028</td>
<td>well thats not good</td>
</tr>
<tr>
<td>jmf028</td>
<td>but hold on</td>
</tr>
<tr>
<td>jmf028</td>
<td>you can go backwards to undo but lets try something</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387065.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 10.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>in this state here:</td>
</tr>
<tr>
<td>jmf028</td>
<td>lets try messing around with loop</td>
</tr>
<tr>
<td>jmf028</td>
<td>one at a time substitute an A for a non A</td>
</tr>
<tr>
<td>jmf028</td>
<td>if it does not stabilize, undo</td>
</tr>
<tr>
<td>jmf028</td>
<td>ready go</td>
</tr>
<tr>
<td>Kalas</td>
<td>it did</td>
</tr>
<tr>
<td>jmf028</td>
<td>good which one</td>
</tr>
<tr>
<td>Kalas</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356387140.png</td>
</tr>
<tr>
<td>Kalas</td>
<td>below a g at the right</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>got the same result</td>
</tr>
<tr>
<td>jmf028</td>
<td>hold on something is weird</td>
</tr>
<tr>
<td>jmf028</td>
<td>why is yours different</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387203.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 11.png]]&nbsp;</td>
</tr>
<tr>
<td>jmf028</td>
<td>this is mine</td>
</tr>
<tr>
<td>Kalas</td>
<td>weird</td>
</tr>
<tr>
<td>jmf028</td>
<td>?</td>
</tr>
<tr>
<td>jmf028</td>
<td>haha</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>we both changed 14 to U</td>
</tr>
<tr>
<td>Kalas</td>
<td>What about you jensen?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>when you said to switch A to non-A in loop</td>
</tr>
<tr>
<td>jmf028</td>
<td>oh</td>
</tr>
<tr>
<td>Kalas</td>
<td>yup</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>we started with 14</td>
</tr>
<tr>
<td>Kalas</td>
<td>16 i think</td>
</tr>
<tr>
<td>jmf028</td>
<td>i meant change non A to A</td>
</tr>
<tr>
<td>jmf028</td>
<td>sorry</td>
</tr>
<tr>
<td>Kalas</td>
<td>oh!</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>NP</td>
</tr>
<tr>
<td>jmf028</td>
<td>just go to this solution</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387303.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 12.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>or sequence</td>
</tr>
<tr>
<td>jmf028</td>
<td>not solution yet</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>so changing 12 to A also stabilizes</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct</td>
</tr>
<tr>
<td>jmf028</td>
<td>now unhighlight G and highlight.....?</td>
</tr>
<tr>
<td>Kalas</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/11100_1356387361.png</td>
</tr>
<tr>
<td>jmf028</td>
<td>which one are you now going to highlight?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>better, we change to A because it connects to fewer</td>
</tr>
<tr>
<td>Kalas</td>
<td>I think i fail to understand this part</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay hold on kalas</td>
</tr>
<tr>
<td>jmf028</td>
<td>switch from non A to A</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>17 changes to U</td>
</tr>
<tr>
<td>jmf028</td>
<td>but ONE at a TIME</td>
</tr>
<tr>
<td>jmf028</td>
<td>so if it doesn't stabilize.....</td>
</tr>
<tr>
<td>Kalas</td>
<td>o</td>
</tr>
<tr>
<td>jmf028</td>
<td>then undo and try another one</td>
</tr>
<tr>
<td>jmf028</td>
<td>does that help?</td>
</tr>
<tr>
<td>Kalas</td>
<td>so we make a change in the unstable</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>sorry, got ahead of you and am now lost...</td>
</tr>
<tr>
<td>Kalas</td>
<td>if it affect the first one</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>ahead</td>
</tr>
<tr>
<td>Kalas</td>
<td>we go and change a non-a</td>
</tr>
<tr>
<td>Kalas</td>
<td>to a</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387494.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 13.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>so here is what it should look like Kalas</td>
</tr>
<tr>
<td>jmf028</td>
<td>and this is after i changed a C to an A</td>
</tr>
<tr>
<td>Kalas</td>
<td>it does right now</td>
</tr>
<tr>
<td>Kalas</td>
<td>yup got back to this point</td>
</tr>
<tr>
<td>jmf028</td>
<td>base 12</td>
</tr>
<tr>
<td>jmf028</td>
<td>highlight this A and unhighlight the G from before if you haven't already</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>k</td>
</tr>
<tr>
<td>jmf028</td>
<td>you good kalas?</td>
</tr>
<tr>
<td>Kalas</td>
<td>yup</td>
</tr>
<tr>
<td>jmf028</td>
<td>ok now switch</td>
</tr>
<tr>
<td>jmf028</td>
<td>what should you do now?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>17 to a U</td>
</tr>
<tr>
<td>Kalas</td>
<td>so i need to change the g to a u?</td>
</tr>
<tr>
<td>jmf028</td>
<td>good job</td>
</tr>
<tr>
<td>jmf028</td>
<td>and what do you do with highlighting part</td>
</tr>
<tr>
<td>Kalas</td>
<td>highlight u</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>unhighlight A highlight U</td>
</tr>
<tr>
<td>Kalas</td>
<td>switch</td>
</tr>
<tr>
<td>jmf028</td>
<td>good job</td>
</tr>
<tr>
<td>jmf028</td>
<td>and yes switch</td>
</tr>
<tr>
<td>jmf028</td>
<td>now the U is destabilizing</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>:)</td>
</tr>
<tr>
<td>Kalas</td>
<td>change non-a to a</td>
</tr>
<tr>
<td>jmf028</td>
<td>what do we do</td>
</tr>
<tr>
<td>jmf028</td>
<td>good job kalas</td>
</tr>
<tr>
<td>jmf028</td>
<td>now in this case, why won't changing G be good</td>
</tr>
<tr>
<td>jmf028</td>
<td>not first but bottom G</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>isnt that the one we just did the time before?</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct</td>
</tr>
<tr>
<td>jmf028</td>
<td>so skip that and try the last one you can</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>#13</td>
</tr>
<tr>
<td>jmf028</td>
<td>right rnj that should stay the same</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>so do we change #18 from U to A</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct rn</td>
</tr>
<tr>
<td>Kalas</td>
<td>no</td>
</tr>
<tr>
<td>Kalas</td>
<td>uhh</td>
</tr>
<tr>
<td>jmf028</td>
<td>what up kalas</td>
</tr>
<tr>
<td>Kalas</td>
<td>How can i see the numbers when i want ?</td>
</tr>
<tr>
<td>jmf028</td>
<td>oh gears below</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>first check box</td>
</tr>
<tr>
<td>Kalas</td>
<td>so much better</td>
</tr>
<tr>
<td>Kalas</td>
<td>thanks</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>show nuc.. numbers</td>
</tr>
<tr>
<td>jmf028</td>
<td>np</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay here is what it should look like so far</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356387860.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 14.png]]</td>
</tr>
<tr>
<td>Kalas</td>
<td>number 18 switched</td>
</tr>
<tr>
<td>jmf028</td>
<td>now switch</td>
</tr>
<tr>
<td>jmf028</td>
<td>yep kalas</td>
</tr>
<tr>
<td>jmf028</td>
<td>do you understand why tho</td>
</tr>
<tr>
<td>Kalas</td>
<td>stabilised the first one</td>
</tr>
<tr>
<td>jmf028</td>
<td>right but why 18 and not 13</td>
</tr>
<tr>
<td>Kalas</td>
<td>we added 13 no?</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct</td>
</tr>
<tr>
<td>jmf028</td>
<td>now from here you can switch back</td>
</tr>
<tr>
<td>Kalas</td>
<td>should we highlight it to remember not to touch it anymore?</td>
</tr>
<tr>
<td>jmf028</td>
<td>no because it gets even more confusing</td>
</tr>
<tr>
<td>Kalas</td>
<td>ok</td>
</tr>
<tr>
<td>jmf028</td>
<td>trust me i tried that before</td>
</tr>
<tr>
<td>jmf028</td>
<td>it makes you think you should change it's base pair</td>
</tr>
<tr>
<td>jmf028</td>
<td>now, with this part do the same thing until you get to another loop in one of the structures</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>thx, I was stuck in that recursive he**</td>
</tr>
<tr>
<td>jmf028</td>
<td>haha</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>so U in 18</td>
</tr>
<tr>
<td>Kalas</td>
<td>so</td>
</tr>
<tr>
<td>Kalas</td>
<td>Can i change number 17 to a?</td>
</tr>
<tr>
<td>jmf028</td>
<td>try not to yet</td>
</tr>
<tr>
<td>jmf028</td>
<td>hold on</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>sorry, U in 11</td>
</tr>
<tr>
<td>jmf028</td>
<td>all right</td>
</tr>
<tr>
<td>jmf028</td>
<td>notice nothing more works other than what we have already tried</td>
</tr>
<tr>
<td>jmf028</td>
<td>so lets undo until everything pairs and the first structure is stabilized :)</td>
</tr>
<tr>
<td>jmf028</td>
<td>this is what we call a trial and error error</td>
</tr>
<tr>
<td>jmf028</td>
<td>but we learned something from it</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>ok, so effectively we try this pattern to its normal conclusion, which is eiher a solve or a dead end</td>
</tr>
<tr>
<td>jmf028</td>
<td>well sometimes rn</td>
</tr>
<tr>
<td>jmf028</td>
<td>but just looking to boost one side without effecting the other [11:36 PM]</td>
</tr>
<tr>
<td>jmf028</td>
<td>in this case it didn't work</td>
</tr>
<tr>
<td>jmf028</td>
<td>but its good to know that trick</td>
</tr>
<tr>
<td>jmf028</td>
<td>becomes useful in the bigger switches</td>
</tr>
<tr>
<td>jmf028</td>
<td>alright should look like this</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388230.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 15.png]]</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>yep,</td>
</tr>
<tr>
<td>jmf028</td>
<td>kalas you good?</td>
</tr>
<tr>
<td>Kalas</td>
<td>yes</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay now be in the same state as this last picture</td>
</tr>
<tr>
<td>Kalas</td>
<td>just done it</td>
</tr>
<tr>
<td>jmf028</td>
<td>look up at the top where it shows an instability in the loop</td>
</tr>
<tr>
<td>jmf028</td>
<td>oh kalas you finished?</td>
</tr>
<tr>
<td>Kalas</td>
<td>no</td>
</tr>
<tr>
<td>jmf028</td>
<td>ok</td>
</tr>
<tr>
<td>Kalas</td>
<td>jim at your state</td>
</tr>
<tr>
<td>Kalas</td>
<td>thats what i said</td>
</tr>
<tr>
<td>Kalas</td>
<td>meant</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay</td>
</tr>
<tr>
<td>Kalas</td>
<td>what i meant</td>
</tr>
<tr>
<td>Kalas</td>
<td>*</td>
</tr>
<tr>
<td>jmf028</td>
<td>so as i said before notice instability in the loop</td>
</tr>
<tr>
<td>jmf028</td>
<td>the open loop</td>
</tr>
<tr>
<td>jmf028</td>
<td>not the middle one</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>k</td>
</tr>
<tr>
<td>jmf028</td>
<td>lets get rid of that shall we</td>
</tr>
<tr>
<td>jmf028</td>
<td>what do we start doing first</td>
</tr>
<tr>
<td>Kalas</td>
<td>change g number 12</td>
</tr>
<tr>
<td>Kalas</td>
<td>to a</td>
</tr>
<tr>
<td>Kalas</td>
<td>?</td>
</tr>
<tr>
<td>Kalas</td>
<td>Highlight a?</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct</td>
</tr>
<tr>
<td>jmf028</td>
<td>notice how that was all you needed to do to stabilize it</td>
</tr>
<tr>
<td>Kalas</td>
<td>yep</td>
</tr>
<tr>
<td>jmf028</td>
<td>now switch and do keep making changes til you get to another loop</td>
</tr>
<tr>
<td>jmf028</td>
<td>op</td>
</tr>
<tr>
<td>jmf028</td>
<td>we did it</td>
</tr>
<tr>
<td>jmf028</td>
<td>its solved</td>
</tr>
<tr>
<td>jmf028</td>
<td>anyone else solve it?</td>
</tr>
<tr>
<td>Kalas</td>
<td>nope, trying</td>
</tr>
<tr>
<td>jmf028</td>
<td>well if you changed the G to an A at the bottom?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>not yet...</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388571.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 16.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>that was from the change</td>
</tr>
<tr>
<td>jmf028</td>
<td>here is what we started with</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388601.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 17.png]]</td>
</tr>
<tr>
<td>jmf028</td>
<td>rn didn't you say change the G to an A</td>
</tr>
<tr>
<td>Kalas</td>
<td>oh</td>
</tr>
<tr>
<td>Kalas</td>
<td>it worked</td>
</tr>
<tr>
<td>jmf028</td>
<td>did you solve it?</td>
</tr>
<tr>
<td>Kalas</td>
<td>yeah</td>
</tr>
<tr>
<td>jmf028</td>
<td>gj kalas</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>sorry, I lost you somewhere, give me a minute</td>
</tr>
<tr>
<td>jmf028</td>
<td>rn start with this sequence</td>
</tr>
<tr>
<td>jmf028</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/55300_1356388675.png</td>
</tr>
<tr>
<td colspan="2">[[File:Basic switch walkthrough chatlog 18.png]]</td>
</tr>
<tr>
<td>Kalas</td>
<td>so this is the easiest switch?</td>
</tr>
<tr>
<td>Kalas</td>
<td>This is hell haha</td>
</tr>
<tr>
<td>jmf028</td>
<td>correct kalas</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>:D</td>
</tr>
<tr>
<td>jmf028</td>
<td>well you get used to it</td>
</tr>
<tr>
<td>jmf028</td>
<td>did you solve it rn?</td>
</tr>
<tr>
<td>Kalas</td>
<td>But with those tricks, i think i get it</td>
</tr>
<tr>
<td>jmf028</td>
<td>thats great kalas</td>
</tr>
<tr>
<td>jmf028</td>
<td>hope that helped</td>
</tr>
<tr>
<td>Kalas</td>
<td>Thanks jmf! ;-)</td>
</tr>
<tr>
<td>jmf028</td>
<td>there are more tricks but they vary in difficulty and your welcome :)</td>
</tr>
<tr>
<td>jmf028</td>
<td>rn did you solve it?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>no I am lost</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>http://eterna.cmu.edu/sites/default/files/chat_screens/60391_1356388815.png</td>
</tr>
<tr>
<td>jmf028</td>
<td>start from the sequence i gave you</td>
</tr>
<tr>
<td>openatheclose</td>
<td>Finishing puzzles with 0/18 GC pairs. #YOLO</td>
</tr>
<tr>
<td>jmf028</td>
<td>okay now try switching</td>
</tr>
<tr>
<td>jmf028</td>
<td>rn that should actually be a solution my bad</td>
</tr>
<tr>
<td>jmf028</td>
<td>didn't mean to show solution</td>
</tr>
<tr>
<td>jmf028</td>
<td>forgot to also change back the U i added</td>
</tr>
<tr>
<td>jmf028</td>
<td>so i gave you answer XD</td>
</tr>
<tr>
<td>jmf028</td>
<td>anyway rn you understand it i think</td>
</tr>
<tr>
<td>jmf028</td>
<td>did the tutorial help at least?</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>yes, I will give this out... not sure how I lost you at the end...</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>the tutorial was really good.</td>
</tr>
<tr>
<td>jmf028</td>
<td>good i'm glad</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>What I struggle with is I can get close, but didn't have a plan for the end game.</td>
</tr>
<tr>
<td>jmf028</td>
<td>yeah that is the fun part for me</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>one struggle is when both puzzles resolve to the same shape because energy isn't right ie molecule doesn't move it</td>
</tr>
<tr>
<td>jmf028</td>
<td>right</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>actually had jet plane to that point, but lost it trying to get energy balanced</td>
</tr>
<tr>
<td>jmf028</td>
<td>that's actually the reason jet plane is so hard</td>
</tr>
<tr>
<td>jmf028</td>
<td>it does that alot</td>
</tr>
<tr>
<td>Jieux</td>
<td>why is jet plane so hard?</td>
</tr>
<tr>
<td>jmf028</td>
<td>joke detected</td>
</tr>
<tr>
<td>jmf028</td>
<td>answer  because it is compiling</td>
</tr>
<tr>
<td>Tesla'sDisciple</td>
<td>jet plane was hard?</td>
</tr>
<tr>
<td>jmf028</td>
<td>oh you guys are too much</td>
</tr>
<tr>
<td>Jieux</td>
<td>I have yet to solve it.</td>
</tr>
<tr>
<td>Jieux</td>
<td>and I'm not doing any switches til I do.</td>
</tr>
<tr>
<td>jmf028</td>
<td>well that is a switch</td>
</tr>
<tr>
<td>jmf028</td>
<td>and therein lies your dilemma</td>
</tr>
<tr>
<td>Jieux</td>
<td>any other switches silly.</td>
</tr>
<tr>
<td>jmf028</td>
<td>:D</td>
</tr>
<tr>
<td>Jieux</td>
<td>8P</td>
</tr>
<tr>
<td>jmf028</td>
<td>did you guys have any other things you would have liked to add to that tutorial?</td>
</tr>
<tr>
<td>Jieux</td>
<td>what tutorial?</td>
</tr>
<tr>
<td>jmf028</td>
<td>the tutorial i just gave for switches</td>
</tr>
<tr>
<td>Tesla'sDisciple</td>
<td>you did a great job jmf</td>
</tr>
<tr>
<td>rnjensen45</td>
<td>agreed, thx again...</td>
</tr>
<tr>
<td>Kalas</td>
<td>yeah thanks!</td>
</tr>
<tr>
<td>Tesla'sDisciple</td>
<td>like you said, there are some other advanced tricks, but you need to get some switches under your belt first</td>
</tr>
<tr>
<td>&nbsp;</td>
<td>&nbsp;</td>
</tr>
</table>
<p>[[Category:Community Chat]][[Category:Guides]]</p>